More

Pinned by Pri Piluinha

View this pin on Pinterest »

comments 8

repins 136

136

Look, it’s my new shoulder tattoo! It’s sort of the classic DNA molecule, splitting off into a structural representation of the sugar-phosphate backbone, with the nucleotide sequence: 5’ - TTTGCTATTACTCATATTTCTAATACTGCTGTTATTCGTACTTGAGAA - 3’ Each set of three base pairs can be translated into an amino acid, which is then represented by a single letter, so my tattoo spells: FAITHISNTAVIRTUEPri Piluinha

Add a Comment:

ADVERTISEMENT

Even more popular pins from the Tattoos Pinterest Category

In memory tattoo

51,817 Repins
11,101 Likes
11 CommentsIn memory tattoo

Tattoos and piercing

39,522 Repins
7,714 Likes
9 CommentsTattoos and piercing

heart tattoo - small tattoo ideas

27,524 Repins
6,385 Likes
9 Commentsheart tattoo - small tattoo ideas

Broken Hearts poem

26,701 Repins
7,517 Likes
8 CommentsBroken Hearts poem

Wear Sunscreen Quote Best quote ever!!!!!

23,638 Repins
7,803 Likes
10 CommentsWear Sunscreen Quote Best quote ever!!!!!

 

View All Popular Pins