
Pinned by Pri Piluinha

View this pin on Pinterest »

comments 8

repins 136


Look, it’s my new shoulder tattoo! It’s sort of the classic DNA

Look, it’s my new shoulder tattoo! It’s sort of the classic DNA molecule, splitting off into a structural representation of the sugar-phosphate backbone, with the nucleotide sequence: 5’ - TTTGCTATTACTCATATTTCTAATACTGCTGTTATTCGTACTTGAGAA - 3’ Each set of three base pairs can be translated into an amino acid, which is then represented by a single letter, so my tattoo spells: FAITHISNTAVIRTUEPri Piluinha


Even more popular pins from the Tattoos Pinterest Category

In memory tattoo

51,817 Repins
11 CommentsIn memory tattoo

Tattoos and piercing

39,522 Repins
9 CommentsTattoos and piercing

heart tattoo - small tattoo ideas

27,524 Repins
9 Commentsheart tattoo - small tattoo ideas

Broken Hearts poem

26,701 Repins
8 CommentsBroken Hearts poem

Wear Sunscreen Quote Best quote ever!!!!!

23,638 Repins
10 CommentsWear Sunscreen Quote Best quote ever!!!!!


View All Popular Pins